hSPAG7 gRNA1 KO plasmidhSPAG7 gRNA2 KO plasmid
Catalog Number: GP03989
Price: Online Inquiry
Catalog Number: GP03989
Price: Online Inquiry
Product Information | |
---|---|
Product Name | hSPAG7 gRNA1 KO plasmidhSPAG7 gRNA2 KO plasmid |
gRNA sequence | CTCCTCTCGATCTTGTTCATTGG(83,0.72),TCAGATTTCATTCAAGACAGTGG(63,0.65) |
Gene | hSPAG7 |
Gene ID | 9552 |
Fluorescence/resistance | EGFP/Puro |
Vector type | Lentiviral vector |
specification | 1ml/tube |
hUSP8 gRNA1 KO plasmidhUSP8 gRNA2 KO plasmid
Learn MorehATG2B gRNA1 KO plasmidhATG2B gRNA2 KO plasmidhATG2B gRNA3 KO plasmid
Learn MorehSLC12A3 gRNA1 KO plasmidhSLC12A3 gRNA2 KO plasmidhSLC12A3 gRNA3 KO plasmid
Learn MorehSIRT5 gRNA1 KO plasmidhSIRT5 gRNA2 KO plasmidhSIRT5 gRNA3 KO plasmid
Learn MorePlease note that all services are for research use only. Not intended for any clinical use.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
There is no product in your cart. |
CD Biosynsis is a leading customer-focused biotechnology company dedicated to providing high-quality products, comprehensive service packages, and tailored solutions to support and facilitate the applications of synthetic biology in a wide range of areas.