Gene Assembly
Learn MoregRNA Plasmids are genetic constructs designed to express guide RNAs (gRNAs) used in CRISPR-Cas9 gene editing systems. The gRNA is a crucial component in CRISPR technology, directing the Cas9 nuclease to a specific DNA sequence for targeted genome modification. gRNA Plasmids typically contain a promoter for gRNA expression and a customizable gRNA sequence that can be tailored to target a specific gene or genomic region. These plasmids are essential tools for precise genetic modifications, enabling researchers to knock out, knock in, or edit genes with high specificity and efficiency in a variety of cell types.
| Catalog Number | Product Name | gRNA sequence | Fluorescence/resistance | Vector type | Price |
|---|---|---|---|---|---|
| GP00001 | MTX3 gRNA10 KO plasmid | AGGCGGCTGGGGACTCCCAT | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00002 | MARK11 gRNA5 KO plasmid | CCAGTTCGGCCTACGACGCC | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00003 | DGKZ gRNA4 KO plasmid | ACTCGCTGCACGGGGCCCCA | Lentiviral vector | Online Inquiry | |
| GP00004 | mCcdc115 gRNA1 KO plasmid | GGCGGTCCAGGCTCTGCGAG | EGFP/puro | Lentiviral vector | Online Inquiry |
| GP00005 | mMgll gRNA3 KO plasmid | TCCTGGTAGGGAACATTCTG | EGFP/Hygro | Lentiviral vector | Online Inquiry |
| GP00006 | hUGDH gRNA2 KO plasmid | ACGCCGTCCATCGAAGATAA | mCherry/neo | Lentiviral vector | Online Inquiry |
| GP00007 | hEGLN1 gRNA2 KO plasmid | GAGCCCGGCTGCGAAACCAT | EGFP/Hygro | Lentiviral vector | Online Inquiry |
| GP00008 | mAtf3 gRNA1 KO plasmid | CCATCGGATGTCCTCTGCGC | Puro | Lentiviral vector | Online Inquiry |
| GP00009 | hMYC gRNA1 KO plasmid | GCCGTATTTCTACTGCGACG | EGFP/puro | Lentiviral vector | Online Inquiry |
| GP00010 | hMT2A gRNA1 KO plasmid | CAGCCTCTTACCGGCGGCGC | puro | Conventional vector | Online Inquiry |
| GP00011 | mSlc2a6 gRNA2 KO plasmid | AAAATCCAGGCATCCTGGTT | Puro | Lentiviral vector | Online Inquiry |
| GP00012 | hBCL2 gRNA3 KO plasmid | CGAGTGGGATGCGGGAGATG | Puro | Lentiviral vector | Online Inquiry |
| GP00013 | mIl17ra gRNA7-gRNA8 KO plasmid | CAGGGACTAATTCTCCGTGC,CTCCTCAACAGGTACTTGTC | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00014 | rDsp gRNA1 KO plasmidrDsp gRNA2 KO plasmidrDsp gRNA3 KO plasmid | CAGCGTGTTGATCCGCGGGT GGG(99,0.67),TGTAGGTCATCTCGTAGCGC AGG(98,0.67),GGTCGTTGACAGTGCAGCGC CGG(93,0.73) | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00015 | hCCDC86 gRNA1 KO plasmidhCCDC86 gRNA2 KO plasmidhCCDC86 gRNA3 KO plasmid | AGCCGTCGGCTGCGCCTTAA CGG(97,0.73),CTCAGTTTCGCGGACGAGAC GGG(97,0.67),TGTCTTCGGCGGCCTTTCGG GGG(93,0.91) | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00016 | rSenp1 gRNA1 KO plasmidrSenp1 gRNA2 KO plasmidrSenp1 gRNA3 KO plasmid | AGCGTCCATCTTCACCCCGT CGG(91,0.72),GGCGGAGCTGTGGTTCACTA AGG(84,0.78),GCCACACTCAGGCTTTCCAG AGG(66,0.72) | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00017 | hHLA-C gRNA11 KO plasmid | GCGACGCCGCGAGTCCAAGA | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00018 | PIK3CA gRNA4 KO plasmid | ATGATGCACGTCATGGTGGC | EGFP/puro | Lentiviral vector | Online Inquiry |
| GP00019 | Recql5 gRNA3-gRNA4 KO plasmid | AGTAGTGAAAATCCGTTTAG,AACCCCAAAAAGATGATGAG | EGFP/puro/cas9 | Conventional vector | Online Inquiry |
| GP00020 | hSIRT6 gRNA3 KO plasmid | CTTCGACCCCCCGGAGGAGC | puro | Lentiviral vector | Online Inquiry |
gRNA Plasmids are extensively used in gene editing applications, where they facilitate the targeted manipulation of specific genes within the genome. In functional genomics, they are employed to create knockout models, where the gRNA directs Cas9 to cleave a specific gene, resulting in its inactivation. This allows researchers to study gene function by observing the resulting phenotypic changes. Additionally, gRNA Plasmids are used in therapeutic research to develop potential treatments for genetic disorders by correcting mutations or introducing beneficial genetic changes in disease models. They also play a critical role in high-throughput screening, where libraries of gRNA plasmids are used to systematically knock out genes across the genome to identify those involved in specific biological pathways or diseases, aiding in the discovery of new drug targets and understanding complex genetic interactions.
By using the gRNA plasmid, the researchers successfully established a complete knockout line of the LmxBTN1 gene. However, the experimental results showed that even when the LmxBTN1 gene was completely knocked out, Leishmania was not significantly different from the wild-type strain in terms of in vitro growth and infectivity. This means that although the LmxBTN1 gene is upregulated at a specific pathogenic stage, it is not a gene required for parasite pathogenicity.(A Ishemgulova, et al.,2018)
Southern blot analysis of the BstE II digested L. mexicana genomic DNA of the WT, Cas9, and BTN1 ablated strains (labeled KO) with LmxM.22.0010 5’ UTR, LmxM.22.0010 3’ UTR and Puro probes.

A, Intensity of infection was assayed on days 2–3 and 7–8 p.i. and defined as weak (less than 100 promastigotes), moderate (100–1,000 promastigotes), or heavy (over 1,000 promastigotes), depending on the number of parasites per gut. Data are summarized from five independent biological replicates, numbers above each bar indicate the total number of dissected females. B, Quantitative PCR analysis of the L. mexicana load in the insect gut 7–8 days p.i. Boxplots are from five independent biological replicates and show 1st quartile, median, 3rd quartile, and 1.5× interquartile range values. C, Localization of parasites in sand fly gut 7–8 days p.i. (SV, stomodeal valve; TH,ABM, both thoracic and abdominal midgut; ABM, abdominal midgut). Numbers above each bar indicate the number of dissected females. D, Morphological analysis of Leishmania mexicana cells from thoracic midgut and stomodeal valve of infected sand fly females 7–8 days p.i. (LN, long nectomonade; SN, short nectomonade; ME, metacyclic promastigote).

Please note that all services are for research use only. Not intended for any clinical use.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
CD Biosynsis is a leading customer-focused biotechnology company dedicated to providing high-quality products, comprehensive service packages, and tailored solutions to support and facilitate the applications of synthetic biology in a wide range of areas.