Home / Products /Genome Editing /gRNA plasmids /hUSP9X gRNA1 KO plasmidhUSP9X gRNA2 KO plasmid

hUSP9X gRNA1 KO plasmidhUSP9X gRNA2 KO plasmid

Catalog Number: GP03667

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUSP9X gRNA1 KO plasmidhUSP9X gRNA2 KO plasmid
gRNA sequence ACTCGTGGCTCTCCGGTCGGAGG(96,0.86),GGGGGCTGAGACTGTCCATCAGG(77,0.62)
Gene hUSP9X
Gene ID 8239
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.