Home / Products /Genome Editing /gRNA plasmids /hTMEM126B gRNA1 KO plasmidhTMEM126B gRNA2 KO plasmid

hTMEM126B gRNA1 KO plasmidhTMEM126B gRNA2 KO plasmid

Catalog Number: GP06996

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hTMEM126B gRNA1 KO plasmidhTMEM126B gRNA2 KO plasmid
gRNA sequence GTGGTGTTCGGGTATGAGGCTGG(78,0.74),TAAGCCAAGGGATTCAGGTGTGG(76,0.76)
Gene hTMEM126B
Gene ID 55863
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.