Home / Products /Genome Editing /gRNA plasmids /hSTOML2 gRNA1 KO plasmidhSTOML2 gRNA2 KO plasmidhSTOML2 gRNA3 KO plasmid

hSTOML2 gRNA1 KO plasmidhSTOML2 gRNA2 KO plasmidhSTOML2 gRNA3 KO plasmid

Catalog Number: GP07570

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSTOML2 gRNA1 KO plasmidhSTOML2 gRNA2 KO plasmidhSTOML2 gRNA3 KO plasmid
gRNA sequence TGGATTGCCCCGAAACACCGTGG(96,0.71),GGGCCGATTCCACCGGATCCTGG(96,0.72),ACTGTTCGTGCCGCAGCAGGAGG(90,0.73)
Gene hSTOML2
Gene ID 30968
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.