hSTOML2 gRNA1 KO plasmidhSTOML2 gRNA2 KO plasmidhSTOML2 gRNA3 KO plasmid
Catalog Number: GP07570
Price: Online Inquiry
Catalog Number: GP07570
Price: Online Inquiry
| Product Information | |
|---|---|
| Product Name | hSTOML2 gRNA1 KO plasmidhSTOML2 gRNA2 KO plasmidhSTOML2 gRNA3 KO plasmid |
| gRNA sequence | TGGATTGCCCCGAAACACCGTGG(96,0.71),GGGCCGATTCCACCGGATCCTGG(96,0.72),ACTGTTCGTGCCGCAGCAGGAGG(90,0.73) |
| Gene | hSTOML2 |
| Gene ID | 30968 |
| Fluorescence/resistance | EGFP/puro/cas9 |
| Vector type | Conventional vector |
| specification | 1ml/tube |
Please note that all services are for research use only. Not intended for any clinical use.
If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.
CD Biosynsis is a leading customer-focused biotechnology company dedicated to providing high-quality products, comprehensive service packages, and tailored solutions to support and facilitate the applications of synthetic biology in a wide range of areas.