Home / Products /Genome Editing /gRNA plasmids /hATP2B1 gRNA1 KO plasmidhATP2B1 gRNA2 KO plasmidhATP2B1 gRNA3 KO plasmid

hATP2B1 gRNA1 KO plasmidhATP2B1 gRNA2 KO plasmidhATP2B1 gRNA3 KO plasmid

Catalog Number: GP05737

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hATP2B1 gRNA1 KO plasmidhATP2B1 gRNA2 KO plasmidhATP2B1 gRNA3 KO plasmid
gRNA sequence GAATTACGCTCGCAGAGCTGCGG(88,0.83),AACAACTCAGTTGCTTACAGTGG(70,0.66),TATTTTTCGTAATGCATCTGTGG(68,0.71)
Gene hATP2B1
Gene ID 490
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.