Home / Products /Genome Editing /gRNA plasmids /hSDF2L1 gRNA1 KO plasmidhSDF2L1 gRNA2 KO plasmidhSDF2L1 gRNA3 KO plasmid

hSDF2L1 gRNA1 KO plasmidhSDF2L1 gRNA2 KO plasmidhSDF2L1 gRNA3 KO plasmid

Catalog Number: GP07773

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSDF2L1 gRNA1 KO plasmidhSDF2L1 gRNA2 KO plasmidhSDF2L1 gRNA3 KO plasmid
gRNA sequence GAGCTCCGCACCGGTCTTGGCGG(93,0.76),CTGGCGCTGTTAGTGCCGGGCGG(88,0.74),CTGCCTGGCCGGTGCTGTTGGGG(76,0.73)
Gene hSDF2L1
Gene ID 23753
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.