Home / Products /Genome Editing /gRNA plasmids /hPSKH1 gRNA1 KO plasmidhPSKH1 gRNA2 KO plasmidhPSKH1 gRNA3 KO plasmid

hPSKH1 gRNA1 KO plasmidhPSKH1 gRNA2 KO plasmidhPSKH1 gRNA3 KO plasmid

Catalog Number: GP04332

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPSKH1 gRNA1 KO plasmidhPSKH1 gRNA2 KO plasmidhPSKH1 gRNA3 KO plasmid
gRNA sequence GCTGGGAACCCGGCTTTGACAGG(92,0.81),TCCGTGTGGCCAGCAGTCGGGGG(86,0.79),CATCCTTGGGTGGCTCGGGAAGG(81,0.71)
Gene hPSKH1
Gene ID 5681
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.