Home / Products /Genome Editing /gRNA plasmids /hPFKP gRNA1 KO plasmidhPFKP gRNA2 KO plasmid

hPFKP gRNA1 KO plasmidhPFKP gRNA2 KO plasmid

Catalog Number: GP07180

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPFKP gRNA1 KO plasmidhPFKP gRNA2 KO plasmid
gRNA sequence AAGATCCTGTCGAATGCCGAAGG(97,0.71),ACACACGTGTGACCATCCTCGGG(88,0.66)
Gene hPFKP
Gene ID 5214
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.