Home / Products /Genome Editing /gRNA plasmids /hOPRM1 gRNA1 KO plasmidhOPRM1 gRNA2 KO plasmidhOPRM1 gRNA3 KO plasmid

hOPRM1 gRNA1 KO plasmidhOPRM1 gRNA2 KO plasmidhOPRM1 gRNA3 KO plasmid

Catalog Number: GP04570

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hOPRM1 gRNA1 KO plasmidhOPRM1 gRNA2 KO plasmidhOPRM1 gRNA3 KO plasmid
gRNA sequence GTGCAATTGCTGGCGTTCGTGGG(97,0.68),CGGTGCGGTTCGGACCGCATGGG(97,0.74),GGAGCAACTTGAGTACGCCAAGG(94,0.65)
Gene hOPRM1
Gene ID 4988
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.