Home / Products /Genome Editing /gRNA plasmids /hL3MBTL3 gRNA1 KO plasmidhL3MBTL3 gRNA2 KO plasmidhL3MBTL3 gRNA3 KO plasmid

hL3MBTL3 gRNA1 KO plasmidhL3MBTL3 gRNA2 KO plasmidhL3MBTL3 gRNA3 KO plasmid

Catalog Number: GP04915

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hL3MBTL3 gRNA1 KO plasmidhL3MBTL3 gRNA2 KO plasmidhL3MBTL3 gRNA3 KO plasmid
gRNA sequence ACTGGATCCTTCAACCTGAAAGG(79,0.71),GTAGATGAGTGTCTTTCTGGAGG(63,0.76),ATTGCAGCCAGAATTGTGCTCGG(69,0.69)
Gene hL3MBTL3
Gene ID 84456
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.