Home / Products /Genome Editing /gRNA plasmids /hITM2B gRNA1 KO plasmidhITM2B gRNA2 KO plasmid

hITM2B gRNA1 KO plasmidhITM2B gRNA2 KO plasmid

Catalog Number: GP06227

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hITM2B gRNA1 KO plasmidhITM2B gRNA2 KO plasmid
gRNA sequence GCAGTCCACCGCGACGGCGTCGG(96,0.81),GGTGACGTTCAACTCCGCTCTGG(95,0.73)
Gene hITM2B
Gene ID 9445
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.