Home / Products /Genome Editing /gRNA plasmids /hGSS gRNA1 KO plasmidhGSS gRNA2 KO plasmidhGSS gRNA3 KO plasmid

hGSS gRNA1 KO plasmidhGSS gRNA2 KO plasmidhGSS gRNA3 KO plasmid

Catalog Number: GP05107

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGSS gRNA1 KO plasmidhGSS gRNA2 KO plasmidhGSS gRNA3 KO plasmid
gRNA sequence TGGCACGGCAGGCCGTGGACCGG(84,0.68),AGTATTGCTGAGGACCTCACAGG(81,0.75),CAAGAGGCTCCCCCAGTTGGTGG(77,0.75)
Gene hGSS
Gene ID 2937
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.