Home / Products /Genome Editing /gRNA plasmids /hSTK17A gRNA1 KO plasmidhSTK17A gRNA2 KO plasmidhSTK17A gRNA3 KO plasmid

hSTK17A gRNA1 KO plasmidhSTK17A gRNA2 KO plasmidhSTK17A gRNA3 KO plasmid

Catalog Number: GP03942

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSTK17A gRNA1 KO plasmidhSTK17A gRNA2 KO plasmidhSTK17A gRNA3 KO plasmid
gRNA sequence GCTGACAGAGATACGCGCCGTGG(98,0.75),AGGCTGTAGCCGTCCTGGAAGGG(80,0.74),CCGCTGCCTGGCTTCTCCAAAGG(64,0.77)
Gene hSTK17A
Gene ID 9263
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.