Home / Products /Genome Editing /gRNA plasmids /hPOGK gRNA1 KO plasmidhPOGK gRNA2 KO plasmidhPOGK gRNA3 KO plasmid

hPOGK gRNA1 KO plasmidhPOGK gRNA2 KO plasmidhPOGK gRNA3 KO plasmid

Catalog Number: GP04415

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPOGK gRNA1 KO plasmidhPOGK gRNA2 KO plasmidhPOGK gRNA3 KO plasmid
gRNA sequence GAAAGTACGAATCTGCTCTGAGG(80,0.77),GATTCAGAGCCGGGAACTAGAGG(87,0.62),CAAATTGAGAGGGTAGGCTGTGG(67,0.74)
Gene hPOGK
Gene ID 57645
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.