Home / TALDO1 Knockout Cell Lines

TALDO1 Knockout Cell Lines

Gene: TALDO1

Official Full Name: transaldolase 1provided by HGNC

Gene Summary: Transaldolase 1 is a key enzyme of the nonoxidative pentose phosphate pathway providing ribose-5-phosphate for nucleic acid synthesis and NADPH for lipid biosynthesis. This pathway can also maintain glutathione at a reduced state and thus protect sulfhydryl groups and cellular integrity from oxygen radicals. The functional gene of transaldolase 1 is located on chromosome 11 and a pseudogene is identified on chromosome 1 but there are conflicting map locations. The second and third exon of this gene were developed by insertion of a retrotransposable element. This gene is thought to be involved in multiple sclerosis. [provided by RefSeq, Jul 2008]

Get A Quote
Products Background Case study

Products

Catalog Number Product Name Species Gene Passage ratio Mycoplasma testing Price
KO00004 TALDO1 Knockout cell line (HT-29) Human TALDO1 1:2~1:4 Negative Online Inquiry
KO00455 TALDO1 knockout cell line (HCT 116) Human TALDO1 1:2~1:4 Negative Online Inquiry
KO35142 TALDO1 Knockout cell line (HeLa) Human TALDO1 1:3~1:6 Negative Online Inquiry
KO35143 TALDO1 Knockout cell line (HEK293) Human TALDO1 1:3~1:6 Negative Online Inquiry
KO35144 TALDO1 Knockout cell line (A549) Human TALDO1 1:3~1:4 Negative Online Inquiry
KOA13449 TALDO1 Knockout cell line (AC16) Human TALDO1 1:3-1:4 negative Online Inquiry
KOA28889 TALDO1 Knockout cell line (BEAS-2B) Human TALDO1 1:3~1:4 negative Online Inquiry
KOA44326 TALDO1 Knockout cell line (U-2932) Human TALDO1 1:2-1:4 negative Online Inquiry
KOA59706 TALDO1 Knockout cell line (TPC-1) Human TALDO1 1:5-1:8 negative Online Inquiry
KOA75130 TALDO1 Knockout cell line (NCM460) Human TALDO1 1:2~1:3 negative Online Inquiry

Background

TALDO1 Gene Knockout Cell Lines represent a powerful tool for researchers aimed at unraveling the complexities of cellular metabolism and its implications for various diseases. TALDO1, or transaldolase 1, is an enzyme involved in the pentose phosphate pathway, crucial for nucleotide and amino acid synthesis. By utilizing gene knockout techniques, these cell lines are engineered to lack functional TALDO1, allowing for detailed studies of metabolic adaptations and compensatory mechanisms within the cell.

The key function of TALDO1 Gene Knockout Cell Lines lies in their ability to provide insight into metabolic pathways that are altered in conditions such as cancer and metabolic disorders. By observing how cells compensate for the loss of TALDO1, researchers can elucidate pathways that may offer novel therapeutic targets. The absence of TALDO1 can lead to metabolic stress, making these cell lines invaluable for studying cellular responses to stressors and potential metabolic reprogramming.

From a scientific perspective, the applications of TALDO1 knockout cell lines are extensive, ranging from basic biological research to clinical studies focusing on disease mechanisms and therapeutic interventions. They can be used to screen for drugs that selectively target altered pathways in TALDO1-deficient cells, offering a promising avenue for precision medicine.

Compared to alternative methods, such as transient knockdown approaches, TALDO1 Gene Knockout Cell Lines provide a stable and reproducible platform for long-term studies, allowing researchers to bypass the transient effects of temporary gene silencing. Furthermore, these cell lines can be easily combined with other genetic modifications, facilitating complex experimental designs.

For researchers and clinicians, the value of TALDO1 Gene Knockout Cell Lines is evident in their potential to drive discoveries that enhance our understanding of metabolism and its role in health and disease. By using these cell lines, researchers can pave the way for novel insights into therapeutic targets that could lead to improved treatment strategies.

Our company specializes in providing high-quality, meticulously characterized cellular models that empower scientists to make significant advancements in biological research. With a commitment to excellence and innovation, we ensure that our products meet the rigorous demands of the research community.

Case study

TALDO1 Gene Knockout Cell Lines for Metabolic Research

Research Focus

To investigate the role of TALDO1 in metabolic regulation by generating and characterizing TALDO1 KO cell lines, and to assess the phenotypic and metabolic changes associated with TALDO1 deficiency.

Background

TALDO1 (transaldolase 1) is a key enzyme in the pentose phosphate pathway (PPP), traditionally thought to localize to the cytoplasm. However, recent research has uncovered its role in regulating broader metabolic networks through nucleocytoplasmic distribution of its isoforms. This case study highlights the utility of TALDO1 gene knockout (KO) cell lines in deciphering the functional impact of TALDO1 loss on metabolic pathways and subcellular localization.

Solution

Cell Line Generation

CRISPR/Cas9 Genome Editing: TALDO1 KO NIH/3T3 mouse cells were generated using the CRISPR-Cas9 system, targeting the murine Taldo1 gene. The guide RNA (gRNA) targeted the sequence "ACCACCGTGGTGGCCGACAC," and KO was confirmed by western blotting and immunofluorescence 312.

Validation: Loss of TALDO1 protein expression was confirmed by the absence of specific bands (~37 kDa) in western blots of KO cell lysates, compared to wild-type (WT) cells.

Functional Assays

1.Subcellular Localization Analysis: Immunofluorescence staining with anti-TALDO1 antibodies revealed loss of nuclear and cytoplasmic TALDO1 staining in KO cells, confirming successful gene disruption 3.

2.Metabolic Profiling: High-performance liquid chromatography with mass spectrometry (HPLC/MS) was used to analyze metabolites in WT, TALDO1 KO, and KO cells reconstituted with TALDO1 or its short isoform (TALDO1S)

Conclusion

1. Metabolic Dysregulation in TALDO1 KO Cells

Pentose Phosphate Pathway (PPP) Dysfunction: TALDO1 KO cells showed a ~6-fold increase in sedoheptulose-7-phosphate (S7P), a substrate of TALDO1, and upregulation of glycolytic intermediates (e.g., glyceraldehyde-3-phosphate [GAP], fructose-1,6-bisphosphate [FBP]).

Broader Metabolic Impact: KO cells exhibited altered levels of tricarboxylic acid (TCA) cycle metabolites (e.g., acetyl-CoA, succinate) and purine nucleotides (e.g., IMP, GMP), indicating TALDO1’s role beyond the PPP.

2. Rescue Experiments Validate TALDO1 Function

Reintroduction of WT TALDO1 or TALDO1S into KO cells normalized S7P and GAP levels, confirming their role in PPP activity.

Cytoplasmic TALDO1S specifically rescued TCA cycle and purine metabolism abnormalities, highlighting isoform-specific metabolic regulation.

3. Subcellular Localization Dynamics

TALDO1 KO cells lacked nuclear and cytoplasmic TALDO1 staining, contrasting with WT cells where the long isoform (TALDO1L) localizes to the nucleus and the short isoform (TALDO1S) to the cytoplasm.

Dimer formation between TALDO1L and TALDO1S was disrupted in KO cells, affecting nucleocytoplasmic shuttling.

TALDO1 Gene Knockout Cell Lines TALDO1 Gene Knockout Cell Lines

Please note that all services are for research use only. Not intended for any clinical use.

Get a free quote

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.