TALDO1 Knockout Cell Lines

To investigate the role of TALDO1 in metabolic regulation by generating and characterizing TALDO1 KO cell lines, and to assess the phenotypic and metabolic changes associated with TALDO1 deficiency.

TALDO1 (transaldolase 1) is a key enzyme in the pentose phosphate pathway (PPP), traditionally thought to localize to the cytoplasm. However, recent research has uncovered its role in regulating broader metabolic networks through nucleocytoplasmic distribution of its isoforms. This case study highlights the utility of TALDO1 gene knockout (KO) cell lines in deciphering the functional impact of TALDO1 loss on metabolic pathways and subcellular localization.

Cell Line Generation

CRISPR/Cas9 Genome Editing: TALDO1 KO NIH/3T3 mouse cells were generated using the CRISPR-Cas9 system, targeting the murine Taldo1 gene. The guide RNA (gRNA) targeted the sequence "ACCACCGTGGTGGCCGACAC," and KO was confirmed by western blotting and immunofluorescence 312.

Validation: Loss of TALDO1 protein expression was confirmed by the absence of specific bands (~37 kDa) in western blots of KO cell lysates, compared to wild-type (WT) cells.

Functional Assays

1.Subcellular Localization Analysis: Immunofluorescence staining with anti-TALDO1 antibodies revealed loss of nuclear and cytoplasmic TALDO1 staining in KO cells, confirming successful gene disruption 3.

2.Metabolic Profiling: High-performance liquid chromatography with mass spectrometry (HPLC/MS) was used to analyze metabolites in WT, TALDO1 KO, and KO cells reconstituted with TALDO1 or its short isoform (TALDO1S)

1. Metabolic Dysregulation in TALDO1 KO Cells

Pentose Phosphate Pathway (PPP) Dysfunction: TALDO1 KO cells showed a ~6-fold increase in sedoheptulose-7-phosphate (S7P), a substrate of TALDO1, and upregulation of glycolytic intermediates (e.g., glyceraldehyde-3-phosphate [GAP], fructose-1,6-bisphosphate [FBP]).

Broader Metabolic Impact: KO cells exhibited altered levels of tricarboxylic acid (TCA) cycle metabolites (e.g., acetyl-CoA, succinate) and purine nucleotides (e.g., IMP, GMP), indicating TALDO1’s role beyond the PPP.

2. Rescue Experiments Validate TALDO1 Function

Reintroduction of WT TALDO1 or TALDO1S into KO cells normalized S7P and GAP levels, confirming their role in PPP activity.

Cytoplasmic TALDO1S specifically rescued TCA cycle and purine metabolism abnormalities, highlighting isoform-specific metabolic regulation.

3. Subcellular Localization Dynamics

TALDO1 KO cells lacked nuclear and cytoplasmic TALDO1 staining, contrasting with WT cells where the long isoform (TALDO1L) localizes to the nucleus and the short isoform (TALDO1S) to the cytoplasm.

Dimer formation between TALDO1L and TALDO1S was disrupted in KO cells, affecting nucleocytoplasmic shuttling.