Home / Products /Genome Editing /gRNA plasmids /hUBE2O gRNA1 KO plasmidhUBE2O gRNA2 KO plasmid

hUBE2O gRNA1 KO plasmidhUBE2O gRNA2 KO plasmid

Catalog Number: GP03722

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hUBE2O gRNA1 KO plasmidhUBE2O gRNA2 KO plasmid
gRNA sequence CTGGTGTCGGGCCGTTACCGTGG(99,0.79),CCGAGTCCTCGCCGTGGATGAGG(92,0.65)
Gene hUBE2O
Gene ID 63893
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.