Home / Products /Genome Editing /gRNA plasmids /hIFIT5 gRNA1 KO plasmidhIFIT5 gRNA2 KO plasmidhIFIT5 gRNA3 KO plasmid

hIFIT5 gRNA1 KO plasmidhIFIT5 gRNA2 KO plasmidhIFIT5 gRNA3 KO plasmid

Catalog Number: GP05018

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hIFIT5 gRNA1 KO plasmidhIFIT5 gRNA2 KO plasmidhIFIT5 gRNA3 KO plasmid
gRNA sequence AATTCGTAAGGACACCTTGAAGG(80,0.7),CTGCTTGTTCCAAGCACTCAAGG(74,0.67),GGTGTTTCACATAGGCCAATAGG(85,0.62)
Gene hIFIT5
Gene ID 24138
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.