Home / Products /Genome Editing /gRNA plasmids /hHM13 gRNA1 KO plasmidhHM13 gRNA2 KO plasmid

hHM13 gRNA1 KO plasmidhHM13 gRNA2 KO plasmid

Catalog Number: GP06499

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hHM13 gRNA1 KO plasmidhHM13 gRNA2 KO plasmid
gRNA sequence TGCCGTTATGCGGATCGCTGAGG(98,0.84),GGCCGCGTAGTGCTGTTGGTGGG(93,0.73)
Gene hHM13
Gene ID 81502
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.