Home / Products /Genome Editing /gRNA plasmids /hGSN gRNA1 KO plasmidhGSN gRNA2 KO plasmidhGSN gRNA3 KO plasmid

hGSN gRNA1 KO plasmidhGSN gRNA2 KO plasmidhGSN gRNA3 KO plasmid

Catalog Number: GP05109

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGSN gRNA1 KO plasmidhGSN gRNA2 KO plasmidhGSN gRNA3 KO plasmid
gRNA sequence GCGTGTGGAGAAGTTCGATCTGG(95,0.66),TGCAGTATGACCTCCACTACTGG(89,0.66),GGAACACCCCGAGTTCCTCAAGG(86,0.71)
Gene hGSN
Gene ID 2934
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.