Home / Products /Genome Editing /gRNA plasmids /hETFA gRNA1 KO plasmidhETFA gRNA2 KO plasmid

hETFA gRNA1 KO plasmidhETFA gRNA2 KO plasmid

Catalog Number: GP05277

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hETFA gRNA1 KO plasmidhETFA gRNA2 KO plasmid
gRNA sequence GCTACGATTTCAGAGTACCCTGG(90,0.69),CACTTCACCTCCAAGGCGTGTGG(88,0.69)
Gene hETFA
Gene ID 2108
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.