Home / Products /Genome Editing /gRNA plasmids /hARPC5L gRNA1 KO plasmidhARPC5L gRNA2 KO plasmid

hARPC5L gRNA1 KO plasmidhARPC5L gRNA2 KO plasmid

Catalog Number: GP05774

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hARPC5L gRNA1 KO plasmidhARPC5L gRNA2 KO plasmid
gRNA sequence ATTCGTCGATGTCCACCCGGCGG(98,0.77),CAAATTTGTGGACGAGCAGGAGG(81,0.6)
Gene hARPC5L
Gene ID 81873
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.