Home / Products /Genome Editing /gRNA plasmids /hSIDT1 gRNA1 KO plasmidhSIDT1 gRNA2 KO plasmidhSIDT1 gRNA3 KO plasmid

hSIDT1 gRNA1 KO plasmidhSIDT1 gRNA2 KO plasmidhSIDT1 gRNA3 KO plasmid

Catalog Number: GP07107

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSIDT1 gRNA1 KO plasmidhSIDT1 gRNA2 KO plasmidhSIDT1 gRNA3 KO plasmid
gRNA sequence CGCCCCTGGCAGCGTCGAAGGGG(95,0.68),CGATCATGTCTACAGCGGGGTGG(95,0.69),GCTGCCTGGGGGATTTCGCCGGG(91,0.72)
Gene hSIDT1
Gene ID 54847
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.