Home / Products /Genome Editing /gRNA plasmids /hNTRK2 gRNA1 KO plasmidhNTRK2 gRNA2 KO plasmidhNTRK2 gRNA3 KO plasmid

hNTRK2 gRNA1 KO plasmidhNTRK2 gRNA2 KO plasmidhNTRK2 gRNA3 KO plasmid

Catalog Number: GP04591

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNTRK2 gRNA1 KO plasmidhNTRK2 gRNA2 KO plasmidhNTRK2 gRNA3 KO plasmid
gRNA sequence CATCGTGGCATTTCCGAGATTGG(94,0.71),GTCGCTGCACCAGATCCGAGAGG(92,0.73),GACCCGCCATGGCGCGGCTCTGG(90,0.68)
Gene hNTRK2
Gene ID 4915
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.