Home / Products /Genome Editing /gRNA plasmids /hNBN gRNA1 KO plasmidhNBN gRNA2 KO plasmidhNBN gRNA3 KO plasmid

hNBN gRNA1 KO plasmidhNBN gRNA2 KO plasmidhNBN gRNA3 KO plasmid

Catalog Number: GP04686

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNBN gRNA1 KO plasmidhNBN gRNA2 KO plasmidhNBN gRNA3 KO plasmid
gRNA sequence CAAGCTATATTGCAACTTGGAGG(81,0.7),CAAGAAGAGCATGCAACCAAAGG(72,0.61),GCGTTGAGTACGTTGTTGGAAGG(92,0.67)
Gene hNBN
Gene ID 4683
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.