Home / Products /Genome Editing /gRNA plasmids /hGPI gRNA1 KO plasmidhGPI gRNA2 KO plasmidhGPI gRNA3 KO plasmid

hGPI gRNA1 KO plasmidhGPI gRNA2 KO plasmidhGPI gRNA3 KO plasmid

Catalog Number: GP07652

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hGPI gRNA1 KO plasmidhGPI gRNA2 KO plasmidhGPI gRNA3 KO plasmid
gRNA sequence TCAGCTCGGAGCGGTGCTCGCGG(91,0.74),GTCCCGGGTGAGAGCGGCCATGG(80,0.67),GGTCCTTGTTGGCATCGAAGAGG(91,0.76)
Gene hGPI
Gene ID 2821
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.