Home / Products /Genome Editing /gRNA plasmids /hCDCA3 gRNA1 KO plasmidhCDCA3 gRNA2 KO plasmidhCDCA3 gRNA3 KO plasmid

hCDCA3 gRNA1 KO plasmidhCDCA3 gRNA2 KO plasmidhCDCA3 gRNA3 KO plasmid

Catalog Number: GP06458

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCDCA3 gRNA1 KO plasmidhCDCA3 gRNA2 KO plasmidhCDCA3 gRNA3 KO plasmid
gRNA sequence GACCCCCGTTCACCTAGTGCTGG(94,0.71),GCCAGATGCTTGTTGTGCGGCGG(92,0.76),GAGGCCGCGCTGGTGTGACTGGG(87,0.69)
Gene hCDCA3
Gene ID 83461
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.