Home / Products /Genome Editing /gRNA plasmids /hOCRL gRNA1 KO plasmidhOCRL gRNA2 KO plasmidhOCRL gRNA3 KO plasmid

hOCRL gRNA1 KO plasmidhOCRL gRNA2 KO plasmidhOCRL gRNA3 KO plasmid

Catalog Number: GP07290

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hOCRL gRNA1 KO plasmidhOCRL gRNA2 KO plasmidhOCRL gRNA3 KO plasmid
gRNA sequence TTGCCCGTTCCTCTGGGCTAGGG(78,0.68),GGAGATGAAGGGTCCTCTCCGGG(62,0.73),GCTGTTCCTTCTCATGCAACTGG(81,0.71)
Gene hOCRL
Gene ID 4952
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.