Home / Products /Genome Editing /gRNA plasmids /hIGF1R gRNA1 KO plasmidhIGF1R gRNA2 KO plasmidhIGF1R gRNA3 KO plasmid

hIGF1R gRNA1 KO plasmidhIGF1R gRNA2 KO plasmidhIGF1R gRNA3 KO plasmid

Catalog Number: GP05012

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hIGF1R gRNA1 KO plasmidhIGF1R gRNA2 KO plasmidhIGF1R gRNA3 KO plasmid
gRNA sequence ATGAGTACAACTACCGCTGCTGG(96,0.65),ACTCTTCTACAACTACGCCCTGG(93,0.7),ACCTGAGGAACATTACTCGGGGG(93,0.68)
Gene hIGF1R
Gene ID 3480
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.