Home / Products /Genome Editing /gRNA plasmids /hWIPI1 gRNA1 KO plasmidhWIPI1 gRNA2 KO plasmidhWIPI1 gRNA3 KO plasmid

hWIPI1 gRNA1 KO plasmidhWIPI1 gRNA2 KO plasmidhWIPI1 gRNA3 KO plasmid

Catalog Number: GP07074

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hWIPI1 gRNA1 KO plasmidhWIPI1 gRNA2 KO plasmidhWIPI1 gRNA3 KO plasmid
gRNA sequence CTAGCAACTGGAACTAAAGCCGG(73,0.68),CAGAGAAAACAGCTTATACCCGG(70,0.64),GAGCAGCTGGATCAAGTCCACGG(70,0.61)
Gene hWIPI1
Gene ID 55062
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.