Home / Products /Genome Editing /gRNA plasmids /hSNAI1 gRNA1 KO plasmidhSNAI1 gRNA2 KO plasmidhSNAI1 gRNA3 KO plasmid

hSNAI1 gRNA1 KO plasmidhSNAI1 gRNA2 KO plasmidhSNAI1 gRNA3 KO plasmid

Catalog Number: GP06748

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSNAI1 gRNA1 KO plasmidhSNAI1 gRNA2 KO plasmidhSNAI1 gRNA3 KO plasmid
gRNA sequence TGTAGTTAGGCTTCCGATTGGGG(95,0.77),GGTCGGAGGGCTTCCTGACGAGG(80,0.84),GTGGGGTTGAGGATCTCCGGAGG(89,0.86)
Gene hSNAI1
Gene ID 6615
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.