Home / Products /Genome Editing /gRNA plasmids /hSLC9A3R2 gRNA1 KO plasmidhSLC9A3R2 gRNA2 KO plasmidhSLC9A3R2 gRNA3 KO plasmid

hSLC9A3R2 gRNA1 KO plasmidhSLC9A3R2 gRNA2 KO plasmidhSLC9A3R2 gRNA3 KO plasmid

Catalog Number: GP04031

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC9A3R2 gRNA1 KO plasmidhSLC9A3R2 gRNA2 KO plasmidhSLC9A3R2 gRNA3 KO plasmid
gRNA sequence CGGGCAGTTCATCCGGCGCGTGG(98,0.67),CGAGGTCAACGGCGTCAACGTGG(98,0.77),CTCCGCGCACCAAGCGGCACAGG(90,0.71)
Gene hSLC9A3R2
Gene ID 9351
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.