Home / Products /Genome Editing /gRNA plasmids /hSLC25A29 gRNA1 KO plasmidhSLC25A29 gRNA2 KO plasmidhSLC25A29 gRNA3 KO plasmid

hSLC25A29 gRNA1 KO plasmidhSLC25A29 gRNA2 KO plasmidhSLC25A29 gRNA3 KO plasmid

Catalog Number: GP08107

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC25A29 gRNA1 KO plasmidhSLC25A29 gRNA2 KO plasmidhSLC25A29 gRNA3 KO plasmid
gRNA sequence GAACACCAGCGCGTTGATGAAGG(95,0.74),ACTGGTTGAGGGGCGAGTCGTGG(93,0.89),GGTGCAGGGCAACACCCTCCGGG(70,0.76)
Gene hSLC25A29
Gene ID 123096
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.