Home / Products /Genome Editing /gRNA plasmids /hSLC17A5 gRNA1 KO plasmidhSLC17A5 gRNA2 KO plasmidhSLC17A5 gRNA3 KO plasmid

hSLC17A5 gRNA1 KO plasmidhSLC17A5 gRNA2 KO plasmidhSLC17A5 gRNA3 KO plasmid

Catalog Number: GP04093

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSLC17A5 gRNA1 KO plasmidhSLC17A5 gRNA2 KO plasmidhSLC17A5 gRNA3 KO plasmid
gRNA sequence TAACGAGCAGAGCAGCACACTGG(74,0.82),GAATCTGAGTGTTGCGTTAGTGG(89,0.63),TTTATGGGAGCAGAATGCTCTGG(62,0.71)
Gene hSLC17A5
Gene ID 26503
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.