Home / Products /Genome Editing /gRNA plasmids /hRPS6KB1 gRNA1 KO plasmidhRPS6KB1 gRNA2 KO plasmid

hRPS6KB1 gRNA1 KO plasmidhRPS6KB1 gRNA2 KO plasmid

Catalog Number: GP04203

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hRPS6KB1 gRNA1 KO plasmidhRPS6KB1 gRNA2 KO plasmid
gRNA sequence CTACTTCGGGTACTTGGTAAAGG(87,0.81),TCAGAAACTAGTGTGAACAGAGG(73,0.75)
Gene hRPS6KB1
Gene ID 6198
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.