Home / Products /Genome Editing /gRNA plasmids /hPTBP3 gRNA1 KO plasmidhPTBP3 gRNA2 KO plasmidhPTBP3 gRNA3 KO plasmid

hPTBP3 gRNA1 KO plasmidhPTBP3 gRNA2 KO plasmidhPTBP3 gRNA3 KO plasmid

Catalog Number: GP04316

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPTBP3 gRNA1 KO plasmidhPTBP3 gRNA2 KO plasmidhPTBP3 gRNA3 KO plasmid
gRNA sequence ACACGGGAAGGCGAACAGGGAGG(73,0.77),CACATGGAATTTTTCGAAGATGG(77,0.61),AGATTAGTTACTTTGCCAAATGG(65,0.62)
Gene hPTBP3
Gene ID 9991
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.