Home / Products /Genome Editing /gRNA plasmids /hSCNN1D gRNA1 KO plasmidhSCNN1D gRNA2 KO plasmidhSCNN1D gRNA3 KO plasmid

hSCNN1D gRNA1 KO plasmidhSCNN1D gRNA2 KO plasmidhSCNN1D gRNA3 KO plasmid

Catalog Number: GP06838

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hSCNN1D gRNA1 KO plasmidhSCNN1D gRNA2 KO plasmidhSCNN1D gRNA3 KO plasmid
gRNA sequence CGCCTCAAGACGACGTCCTGGGG(96,0.82),TGAGCGTCACTGGCACCGCCCGG(91,0.65),ATCCGCCTGGTCTGCTCCCGCGG(90,0.75)
Gene hSCNN1D
Gene ID 6339
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.