Home / Products /Genome Editing /gRNA plasmids /hPPP4R3B gRNA1 KO plasmidhPPP4R3B gRNA2 KO plasmidhPPP4R3B gRNA3 KO plasmid

hPPP4R3B gRNA1 KO plasmidhPPP4R3B gRNA2 KO plasmidhPPP4R3B gRNA3 KO plasmid

Catalog Number: GP06940

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPPP4R3B gRNA1 KO plasmidhPPP4R3B gRNA2 KO plasmidhPPP4R3B gRNA3 KO plasmid
gRNA sequence CCTGAACGAAGACCGGCAATGGG(96,0.68),GGATACGCGGCGGCGAGTGAAGG(95,0.72),GCACGTCTCCTCCACTTACGTGG(94,0.81)
Gene hPPP4R3B
Gene ID 57223
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.