Home / Products /Genome Editing /gRNA plasmids /hPIK3C2B gRNA1 KO plasmidhPIK3C2B gRNA2 KO plasmid

hPIK3C2B gRNA1 KO plasmidhPIK3C2B gRNA2 KO plasmid

Catalog Number: GP04463

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hPIK3C2B gRNA1 KO plasmidhPIK3C2B gRNA2 KO plasmid
gRNA sequence AACCGAAAGAATGCGACGCCTGG(98,0.66),ACCGACCTCAAGCTGTTACGCGG(93,0.72)
Gene hPIK3C2B
Gene ID 5287
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.