Home / Products /Genome Editing /gRNA plasmids /hOASL gRNA1 KO plasmidhOASL gRNA2 KO plasmidhOASL gRNA3 KO plasmid

hOASL gRNA1 KO plasmidhOASL gRNA2 KO plasmidhOASL gRNA3 KO plasmid

Catalog Number: GP04580

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hOASL gRNA1 KO plasmidhOASL gRNA2 KO plasmidhOASL gRNA3 KO plasmid
gRNA sequence GCTAGACGCTGTGCGGACCGTGG(97,0.8),CTGCAGCCACTGAGCCACGAAGG(80,0.65),CTCTTCCTTCCACTCCCGGTGGG(79,0.66)
Gene hOASL
Gene ID 8638
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.