Home / Products /Genome Editing /gRNA plasmids /hNDC1 gRNA1 KO plasmidhNDC1 gRNA2 KO plasmidhNDC1 gRNA3 KO plasmid

hNDC1 gRNA1 KO plasmidhNDC1 gRNA2 KO plasmidhNDC1 gRNA3 KO plasmid

Catalog Number: GP04674

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hNDC1 gRNA1 KO plasmidhNDC1 gRNA2 KO plasmidhNDC1 gRNA3 KO plasmid
gRNA sequence ATTTGTTTCATCCTATACAGTGG(76,0.69),ATAAATACTGTGGTGCAGATGGG(73,0.62),AGATTACATAGGAACTATACAGG(84,0.72)
Gene hNDC1
Gene ID 55706
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.