Home / Products /Genome Editing /gRNA plasmids /hLYAR gRNA1 KO plasmidhLYAR gRNA2 KO plasmidhLYAR gRNA3 KO plasmid

hLYAR gRNA1 KO plasmidhLYAR gRNA2 KO plasmidhLYAR gRNA3 KO plasmid

Catalog Number: GP07026

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hLYAR gRNA1 KO plasmidhLYAR gRNA2 KO plasmidhLYAR gRNA3 KO plasmid
gRNA sequence CTTCACTTATGCATTTCACGTGG(79,0.7),CAAAGGCGACATCAAACAGCAGG(77,0.62),TATGGTGGCAAAGGCTATGAAGG(68,0.74)
Gene hLYAR
Gene ID 55646
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.