Home / Products /Genome Editing /gRNA plasmids /hKIF22 gRNA1 KO plasmidhKIF22 gRNA2 KO plasmidhKIF22 gRNA3 KO plasmid

hKIF22 gRNA1 KO plasmidhKIF22 gRNA2 KO plasmidhKIF22 gRNA3 KO plasmid

Catalog Number: GP07464

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hKIF22 gRNA1 KO plasmidhKIF22 gRNA2 KO plasmidhKIF22 gRNA3 KO plasmid
gRNA sequence ACTCAGCAGGACATCTATGCAGG(81,0.73),ATCCTAAGGCACTTGCTGGAAGG(77,0.67),AATGCCAGTGTGCTTGCCTATGG(75,0.76)
Gene hKIF22
Gene ID 3835
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.