Home / Products /Genome Editing /gRNA plasmids /hFAM207A gRNA1 KO plasmidhFAM207A gRNA2 KO plasmidhFAM207A gRNA3 KO plasmid

hFAM207A gRNA1 KO plasmidhFAM207A gRNA2 KO plasmidhFAM207A gRNA3 KO plasmid

Catalog Number: GP06380

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hFAM207A gRNA1 KO plasmidhFAM207A gRNA2 KO plasmidhFAM207A gRNA3 KO plasmid
gRNA sequence GTTGCGCGCCCGAGTGCACCAGG(95,0.69),GCCGGCGGAGGGGTCGCCTCCGG(86,0.81),TGCCGTGAGGCCGAAAGGGGAGG(83,0.7)
Gene hFAM207A
Gene ID 85395
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.