Home / Products /Genome Editing /gRNA plasmids /hDAPK3 gRNA1 KO plasmidhDAPK3 gRNA2 KO plasmidhDAPK3 gRNA3 KO plasmid

hDAPK3 gRNA1 KO plasmidhDAPK3 gRNA2 KO plasmidhDAPK3 gRNA3 KO plasmid

Catalog Number: GP08009

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hDAPK3 gRNA1 KO plasmidhDAPK3 gRNA2 KO plasmidhDAPK3 gRNA3 KO plasmid
gRNA sequence GTTCTCGAAGATGTCGTGCAGGG(97,0.71),GCCTGTCATCCAGCCGGCGTGGG(92,0.71),GTGCGGAAGTGCCGGCAGAAGGG(90,0.65)
Gene hDAPK3
Gene ID 1613
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.