Home / Products /Genome Editing /gRNA plasmids /hCDC14B gRNA1 KO plasmidhCDC14B gRNA2 KO plasmidhCDC14B gRNA3 KO plasmid

hCDC14B gRNA1 KO plasmidhCDC14B gRNA2 KO plasmidhCDC14B gRNA3 KO plasmid

Catalog Number: GP05584

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCDC14B gRNA1 KO plasmidhCDC14B gRNA2 KO plasmidhCDC14B gRNA3 KO plasmid
gRNA sequence CGCTGCTCGTCGACCTCGCCGGG(93,0.67),CTGCGGATCTTCTTCACACCCGG(89,0.7),GCGGCGCGGGTCTTGCTGCGTGG(85,0.74)
Gene hCDC14B
Gene ID 8555
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.