Home / Products /Genome Editing /gRNA plasmids /hCAT gRNA1 KO plasmidhCAT gRNA2 KO plasmidhCAT gRNA3 KO plasmid

hCAT gRNA1 KO plasmidhCAT gRNA2 KO plasmidhCAT gRNA3 KO plasmid

Catalog Number: GP06402

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hCAT gRNA1 KO plasmidhCAT gRNA2 KO plasmidhCAT gRNA3 KO plasmid
gRNA sequence TTATTACAGTAGGGCCCCGTGGG(96,0.66),TACTGGGTTACCAGCTCCAGTGG(72,0.7),GAGAGAGTTGTGCATGCTAAAGG(72,0.71)
Gene hCAT
Gene ID 847
Fluorescence/resistance EGFP/puro/cas9
Vector type Conventional vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.