Home / Products /Genome Editing /gRNA plasmids /hANXA11 gRNA1 KO plasmidhANXA11 gRNA2 KO plasmidhANXA11 gRNA3 KO plasmid

hANXA11 gRNA1 KO plasmidhANXA11 gRNA2 KO plasmidhANXA11 gRNA3 KO plasmid

Catalog Number: GP05815

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hANXA11 gRNA1 KO plasmidhANXA11 gRNA2 KO plasmidhANXA11 gRNA3 KO plasmid
gRNA sequence GGCTGCCCAAAGCCGCCAGGGGG(76,0.74),ACTGGTGGGTAGCCAGCCCCAGG(68,0.74),CATGCCCAACCTGTACCCTGGGG(67,0.71)
Gene hANXA11
Gene ID 311
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.