Home / Products /Genome Editing /gRNA plasmids /hYIF1A gRNA1 KO plasmidhYIF1A gRNA2 KO plasmid

hYIF1A gRNA1 KO plasmidhYIF1A gRNA2 KO plasmid

Catalog Number: GP03625

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hYIF1A gRNA1 KO plasmidhYIF1A gRNA2 KO plasmid
gRNA sequence CTCTTCGATGACACAAGCGGTGG(95,0.65),GGTTATTCCAGCCAGCCCGGGGG(87,0.72)
Gene hYIF1A
Gene ID 10897
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.