Home / Products /Genome Editing /gRNA plasmids /hWDR6 gRNA1 KO plasmidhWDR6 gRNA2 KO plasmidhWDR6 gRNA3 KO plasmid

hWDR6 gRNA1 KO plasmidhWDR6 gRNA2 KO plasmidhWDR6 gRNA3 KO plasmid

Catalog Number: GP03642

Price: Online Inquiry

Specifications Downloads Related products

Specifications

Product Information
Product Name hWDR6 gRNA1 KO plasmidhWDR6 gRNA2 KO plasmidhWDR6 gRNA3 KO plasmid
gRNA sequence AGCGTCCATGTCGATCCTCGAGG(98,0.81),TCGAGGACTACGTTTGGCCGCGG(98,0.8),ACGCACTCCAGACCCGTCACTGG(92,0.7)
Gene hWDR6
Gene ID 11180
Fluorescence/resistance EGFP/Puro
Vector type Lentiviral vector
specification 1ml/tube

Downloads

Please note that all services are for research use only. Not intended for any clinical use.

Ask a Question

If your question is not addressed through these resources, you can fill out the online form below and we will answer your question as soon as possible.